Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.180226 |
Chromosome: | chromosome 16 |
Location: | 1629624 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g654300 | NDK5,RSP23 | (1 of 1) PF00334//PF00612//PF05186 - Nucleoside diphosphate kinase (NDK) // IQ calmodulin-binding motif (IQ) // Dpy-30 motif (Dpy-30); Radial Spoke Protein 23 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCAAGCAACCACGGCGTGGCAGGGGCGC |
Internal bar code: | GTACTCTGATGTGGCGCTCAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 855 |
LEAP-Seq percent confirming: | 99.1304 |
LEAP-Seq n confirming: | 114 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTATAGGCAAAGACGAGG |
Suggested primer 2: | CACTATGCAGCTCTGGGTCA |