| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.180226 |
| Chromosome: | chromosome 16 |
| Location: | 1629629 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g654300 | NDK5,RSP23 | (1 of 1) PF00334//PF00612//PF05186 - Nucleoside diphosphate kinase (NDK) // IQ calmodulin-binding motif (IQ) // Dpy-30 motif (Dpy-30); Radial Spoke Protein 23 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATATCATCCCCAAACAGCGACTCACCTG |
| Internal bar code: | GAACGGCCGGGCAAGCACGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 922 |
| LEAP-Seq percent confirming: | 98.4445 |
| LEAP-Seq n confirming: | 2405 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTATAGGCAAAGACGAGG |
| Suggested primer 2: | CACTATGCAGCTCTGGGTCA |