| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.180238 |
| Chromosome: | chromosome 3 |
| Location: | 7554798 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205050 | CGLD24,DOT1,DGTT4 | Diacylglycerol acyltransferase, DGAT Type 2; (1 of 4) K14457 - 2-acylglycerol O-acyltransferase 2 (MOGAT2, MGAT2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACTCACGCCACATACACGTGCCCTCCG |
| Internal bar code: | GCACCACGACTTCACCGACGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 772 |
| LEAP-Seq percent confirming: | 96.2371 |
| LEAP-Seq n confirming: | 32327 |
| LEAP-Seq n nonconfirming: | 1264 |
| LEAP-Seq n unique pos: | 127 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTTTGGGAAGGAGGAAT |
| Suggested primer 2: | TGCTGTTTTACTGCCACTGC |