Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.180288 |
Chromosome: | chromosome 17 |
Location: | 4324068 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g730950 | KIN2-2,KHP1,FLA10 | Kinesin-II Motor Protein; (1 of 2) K10394 - kinesin family member 3/17 (KIF3_17) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCACCACCGCACTCCGGGACTGGGCTAC |
Internal bar code: | TGAGGAGGTACGTTGTTCGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 384 |
LEAP-Seq percent confirming: | 99.7777 |
LEAP-Seq n confirming: | 4489 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAGCTAATCCTGCAAATG |
Suggested primer 2: | CAAATACTTATCGCAGCGCA |