| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.180311 |
| Chromosome: | chromosome 6 |
| Location: | 6323387 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g291800 | COQ2 | (1 of 1) 2.5.1.39 - 4-hydroxybenzoate polyprenyltransferase / 4-hydroxybenzoate nonaprenyltransferase; Para-hydroxybenzoate-polyprenyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTTGGGTCCAAACCCTCCACACATTCC |
| Internal bar code: | CCAAGCGCTCGTAAGCCTAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 767 |
| LEAP-Seq percent confirming: | 90.2573 |
| LEAP-Seq n confirming: | 1649 |
| LEAP-Seq n nonconfirming: | 178 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACGTGGATCTGGAGAACG |
| Suggested primer 2: | CCTTGTGACCTGGTGATGTG |