Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.180478 |
Chromosome: | chromosome 12 |
Location: | 5321338 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g529250 | (1 of 8) PTHR11339//PTHR11339:SF290 - EXTRACELLULAR MATRIX GLYCOPROTEIN RELATED // PROTEIN T26A8.1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGACGTCAAAGTTTGGGCTGTGAATTCA |
Internal bar code: | TGCGACTAAGGGACCAGGTCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 443 |
LEAP-Seq percent confirming: | 99.5413 |
LEAP-Seq n confirming: | 3038 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCAGCCTAAGGTCTGTACG |
Suggested primer 2: | CGACACAAACCCCTTGAGTT |