| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.180504 |
| Chromosome: | chromosome 5 |
| Location: | 2785005 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g237100 | MOT52 | Predicted protein; (1 of 1) K16535 - lisH domain-containing protein FOPNL (FOPNL, FOR20) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACAAACATGGCTTCTGTCGAGGACCTTA |
| Internal bar code: | TGGGAACCCGCCCGACCTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1057 |
| LEAP-Seq percent confirming: | 99.7478 |
| LEAP-Seq n confirming: | 2373 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTCTATCGTATGTCGGCT |
| Suggested primer 2: | GCGGTAGGCATTGTACACCT |