| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.180542 |
| Chromosome: | chromosome 9 |
| Location: | 5959185 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402812 | (1 of 6) PF02656 - Domain of unknown function (DUF202) (DUF202) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCACTTGCCTGACAGAGCCGCCGCGAT |
| Internal bar code: | CGGCCACTCGGACGCCCGCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 686 |
| LEAP-Seq percent confirming: | 99.831 |
| LEAP-Seq n confirming: | 4135 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGAGGAGCCAAGAAGGATG |
| Suggested primer 2: | CCGAGGAGTTTCGATAGCTG |