| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.180554 |
| Chromosome: | chromosome 9 |
| Location: | 5019802 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398104 | (1 of 1) K19306 - 18S rRNA (guanine1575-N7)-methyltransferase [EC:2.1.1.309] (BUD23) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATACATCGGTGACCGGTATGCTTCTCTGG |
| Internal bar code: | GGTACCACTTGGAAGACACCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 560 |
| LEAP-Seq percent confirming: | 93.3311 |
| LEAP-Seq n confirming: | 5584 |
| LEAP-Seq n nonconfirming: | 399 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTGTGACCCTCATCAGCA |
| Suggested primer 2: | CAGCGTAAAAAGAAGGTCGC |