| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.180652 |
| Chromosome: | chromosome 12 |
| Location: | 3820859 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515400 | (1 of 17) PF08016 - Polycystin cation channel (PKD_channel) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCCATCATGCCCGCCCAGTCCACCGCGC |
| Internal bar code: | ACCCTTAGAGCTCCACTAAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 558 |
| LEAP-Seq percent confirming: | 91.9414 |
| LEAP-Seq n confirming: | 1004 |
| LEAP-Seq n nonconfirming: | 88 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTTCAGAACCCCCGAACT |
| Suggested primer 2: | CTCCTGGGTGTGCAATACCT |