| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.180689 |
| Chromosome: | chromosome 2 |
| Location: | 4280765 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099055 | (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGCACGATGGCCAATGCGCCGCCCTCA |
| Internal bar code: | GGGGGAGGACCGAACGCTTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1082 |
| LEAP-Seq percent confirming: | 82.5013 |
| LEAP-Seq n confirming: | 1603 |
| LEAP-Seq n nonconfirming: | 340 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAGCAGCATGAGACGTTG |
| Suggested primer 2: | CGTATCCCATCCAAGCAAGT |