| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.180711 |
| Chromosome: | chromosome 2 |
| Location: | 1493478 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g084100 | (1 of 24) IPR006553 - Leucine-rich repeat, cysteine-containing subtype | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAAAGCGAAGGTATTGATCCCCCAGAGT |
| Internal bar code: | AAGAGGTAGCAACGTCGATTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 778 |
| LEAP-Seq percent confirming: | 98.8255 |
| LEAP-Seq n confirming: | 3534 |
| LEAP-Seq n nonconfirming: | 42 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTCCAGCTCGAAGTTGCT |
| Suggested primer 2: | GGATGCGCCTTAACGAAATA |