Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.180729 |
Chromosome: | chromosome 2 |
Location: | 3329369 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095090 | (1 of 25) IPR013216//IPR029063 - Methyltransferase type 11 // S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGTCCCATCACCCCTGAGGCTAGCTAA |
Internal bar code: | CATATAACGGGCTACGCTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 935 |
LEAP-Seq percent confirming: | 97.2704 |
LEAP-Seq n confirming: | 3421 |
LEAP-Seq n nonconfirming: | 96 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCATTCACTCGCAAGCAC |
Suggested primer 2: | AGGACGGACTGCAATCAAAC |