| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.180876 |
| Chromosome: | chromosome 7 |
| Location: | 1612292 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325000 | CYP18,CYP738A1 | Cytochrome P450, CYP120 superfamily; (1 of 4) 1.14.13.93 - (+)-abscisic acid 8'-hydroxylase / ABA 8'-hydroxylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGACAAAGCGGCCCAGCTAGACACTATA |
| Internal bar code: | TCATTGTTGGTAAACTTGTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 91 |
| LEAP-Seq percent confirming: | 91.3223 |
| LEAP-Seq n confirming: | 221 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGGTATGAATGTGGCTTGA |
| Suggested primer 2: | GGTGCACCCTGTTGTTTCTT |