| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.180902 |
| Chromosome: | chromosome 13 |
| Location: | 5095279 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607300 | FAP352,MAPK5 | (1 of 1) K08293 - mitogen-activated protein kinase [EC:2.7.11.24] (E2.7.11.24); Flagellar Associated Protein 352 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAAGCTCACCCCCTTGCCCAGCTTTTGC |
| Internal bar code: | GACTGGCCATTGGGCTCGCTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 694 |
| LEAP-Seq percent confirming: | 99.2053 |
| LEAP-Seq n confirming: | 1498 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGTACAGCACATGATCC |
| Suggested primer 2: | ACTGCCGCACTAGCTGTACC |