| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.180919 |
| Chromosome: | chromosome 4 |
| Location: | 1288680 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214800 | VMPL1,VMP6 | (1 of 10) PF00957 - Synaptobrevin (Synaptobrevin); Endosomal R-SNARE protein, VAMP-like family (R.III) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTCCGGTGGCGCCACCGGCCTGCGCGGG |
| Internal bar code: | CTAACGCTTCCGTTCCCTCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 549 |
| LEAP-Seq percent confirming: | 98.5573 |
| LEAP-Seq n confirming: | 1093 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTCAGCCGCCTGTTATCC |
| Suggested primer 2: | TCGGTTTAGTTTGATTGGGC |