| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.181092 |
| Chromosome: | chromosome 1 |
| Location: | 3226547 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g020223 | FUM2 | (1 of 1) K01679 - fumarate hydratase, class II (E4.2.1.2B, fumC); Fumarate hydratase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAGGCAACTAAAGTTATCACTTGCGGGG |
| Internal bar code: | GCTCAATCCCGGCACGCCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 513 |
| LEAP-Seq percent confirming: | 91.2661 |
| LEAP-Seq n confirming: | 1348 |
| LEAP-Seq n nonconfirming: | 129 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAGGTCAACCCGACACAA |
| Suggested primer 2: | CTTGAATGACTCGGCTGTCA |