| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.181104 |
| Chromosome: | chromosome 4 |
| Location: | 2935651 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g224667 | intron | ||
| Cre04.g224683 | (1 of 1) IPR001609//IPR027417 - Myosin head, motor domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAATGATGCTAGCTGCGGGCATGCGCAAC |
| Internal bar code: | GACCATGGCTATCGATGACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 212 |
| LEAP-Seq percent confirming: | 94.2857 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCACACCACATTCACAA |
| Suggested primer 2: | GGCAGGGGACTATATTGGGT |