Insertion junction: LMJ.RY0402.181108_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.181108
Chromosome:chromosome_9
Location:6540131
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre09.g407801 AKC1 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CAACCCGGCGGGGCGGGGGGCGGCTGTAGA
Internal bar code:CGGCGAGGAAGGTGCGGACGGG

Confirmation - LEAP-Seq

LEAP-Seq distance:860
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:328
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:12

Suggested primers for confirmation by PCR

Suggested primer 1:CACCTTACAACACGCACCAC
Suggested primer 2:CCAAACACGATGCATACCAG