Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.181193 |
Chromosome: | chromosome 16 |
Location: | 1513990 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g653150 | CPR3 | (1 of 2) PF01841 - Transglutaminase-like superfamily (Transglut_core); Cysteine protease, transglutaminase-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAACCGCAACAGGCCAACAGCGGTGTCTA |
Internal bar code: | TAGTGTACCGAGGGCGGCTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 633 |
LEAP-Seq percent confirming: | 85.3357 |
LEAP-Seq n confirming: | 966 |
LEAP-Seq n nonconfirming: | 166 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
Suggested primer 2: | GTCGTACCACACACAGGTGC |