Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.181206 |
Chromosome: | chromosome 9 |
Location: | 4663144 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396735 | (1 of 1) PTHR18895:SF3 - METHYLTRANSFERASE-LIKE PROTEIN 20 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCACCACGCTGGCCGCGCCGTACTTGAG |
Internal bar code: | GTAGGAGTGTGCAGCCACCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 471 |
LEAP-Seq percent confirming: | 71.193 |
LEAP-Seq n confirming: | 16489 |
LEAP-Seq n nonconfirming: | 6672 |
LEAP-Seq n unique pos: | 121 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCTTGACCACGAAGTCCT |
Suggested primer 2: | CGTGAAATGGCGAGTGTATG |