| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.181207 |
| Chromosome: | chromosome 6 |
| Location: | 1556192 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260250 | CEMA,CEM1,YCF10 | putative proton extrusion protein cemA, chloroplastic; (1 of 1) PTHR33650:SF1 - CEMA-LIKE PROTON EXTRUSION PROTEIN-LIKE PROTEIN | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAAGGAGGCAGCAATGCAGGTCCAGGGC |
| Internal bar code: | CTCTAACTCAGCACAGGTTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 241 |
| LEAP-Seq percent confirming: | 98.2036 |
| LEAP-Seq n confirming: | 164 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAATCAGGTGAGGTGAGGG |
| Suggested primer 2: | CACATATGGCCATCAGCATC |