| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.181355 |
| Chromosome: | chromosome 16 |
| Location: | 1886641 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g655750 | TEK1,p58 | (1 of 1) PTHR19960//PTHR19960:SF25 - TEKTIN // TEKTIN-1; Tektin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGCTCGCGGCGGGCGCTGGTGAGGCT |
| Internal bar code: | CTATTTTAACATACTGCTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 319 |
| LEAP-Seq percent confirming: | 11.6279 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATCAAGGCTTCATCACCC |
| Suggested primer 2: | GCCTATTACGCACGGAACAT |