| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.181401 |
| Chromosome: | chromosome 11 |
| Location: | 2803150 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g477450 | (1 of 587) 2.7.11.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAAACACAGTATCCTGCAAATCGTGTG |
| Internal bar code: | CTTACGGTGAGGGCTTTCGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 778 |
| LEAP-Seq percent confirming: | 99.65 |
| LEAP-Seq n confirming: | 3701 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCTACGTTTGGGTGTTGC |
| Suggested primer 2: | AGGTTCGGTTAACTTGGGCT |