| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.181443 |
| Chromosome: | chromosome 12 |
| Location: | 2616429 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g504950 | UO,UOX1,UOX | Urate oxidase II; (1 of 1) K00365 - urate oxidase (uaZ) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCCGCAGGAACATCCTCGACCGTGTGC |
| Internal bar code: | GCAATCTGTCCGGCATGGGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 907 |
| LEAP-Seq percent confirming: | 99.493 |
| LEAP-Seq n confirming: | 2551 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTCCACCCTGTTCAGTT |
| Suggested primer 2: | CACTAGCCCTATCCGAGCAG |