| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.181456 |
| Chromosome: | chromosome 4 |
| Location: | 2224857 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g220050 | (1 of 112) 2.7.11.25 - Mitogen-activated protein kinase kinase kinase / MLTK | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGCTGATTAGCATGCACAGATCCAGACC |
| Internal bar code: | GGGGGGATGTGTGGTTGGTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 760 |
| LEAP-Seq percent confirming: | 99.916 |
| LEAP-Seq n confirming: | 1190 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACTCAATTTGGGACGGGT |
| Suggested primer 2: | CATTGCATTGCTGCTTGAAT |