Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.181468 |
Chromosome: | chromosome 12 |
Location: | 8471946 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g548100 | UBC7 | (1 of 11) PF00632 - HECT-domain (ubiquitin-transferase) (HECT); Putative Ubiquitin-protein ligase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGCCAGCACCTCTGCTCTCACTCCGTC |
Internal bar code: | GCGCGTTGTAATAAACGGAGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 48 |
LEAP-Seq percent confirming: | 93.8272 |
LEAP-Seq n confirming: | 76 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGAGATGCTTTCCGAGTTC |
Suggested primer 2: | GGGAAGCTGTTACAAACCCA |