Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.181471 |
Chromosome: | chromosome 2 |
Location: | 7147464 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g146550 | (1 of 1) PF14251 - Domain of unknown function (DUF4346) (DUF4346) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACTTCATCCCCCCGGCCTTGCACGCGG |
Internal bar code: | TGGAGAGTCGCCCGTCCGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 541 |
LEAP-Seq percent confirming: | 98.9268 |
LEAP-Seq n confirming: | 100018 |
LEAP-Seq n nonconfirming: | 1085 |
LEAP-Seq n unique pos: | 206 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACCCCAACACGTCTATCT |
Suggested primer 2: | GAGGGTCAAACACACCTCGT |