Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.181479 |
Chromosome: | chromosome 8 |
Location: | 3337623 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g374050 | DIV28,POLD2 | (1 of 1) K02328 - DNA polymerase delta subunit 2 (POLD2); DNA polymerase delta, small subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAACAAGGGTGCAGAGGGAGATCCATGGG |
Internal bar code: | ATAAAGCGGTTTATTTCTGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 537 |
LEAP-Seq percent confirming: | 98.6517 |
LEAP-Seq n confirming: | 1756 |
LEAP-Seq n nonconfirming: | 24 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCTCGCCATCCACTTCTC |
Suggested primer 2: | TATACACCCCTTCCATCCCA |