Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.181523 |
Chromosome: | chromosome 13 |
Location: | 4077508 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g591300 | (1 of 18) PTHR19862:SF14 - WD REPEAT-CONTAINING PROTEIN 48 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTTGGCTCGACGCCTATGTCAAGATGAA |
Internal bar code: | GGTGCAGCGCCAGCAATTTTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1040 |
LEAP-Seq percent confirming: | 90.2602 |
LEAP-Seq n confirming: | 5931 |
LEAP-Seq n nonconfirming: | 640 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGGCTTTACTGCTGCTAT |
Suggested primer 2: | TCTATGCCCACACCAATGAA |