Insertion junction: LMJ.RY0402.181529_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.181529
Chromosome:chromosome_13
Location:1618857
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGTGTATGTGTGTGCAGGTTTTGAGGGTA
Internal bar code:TTCATGAACACTCGGCTTCCTA

Confirmation - LEAP-Seq

LEAP-Seq distance:582
LEAP-Seq percent confirming:99.3677
LEAP-Seq n confirming:7858
LEAP-Seq n nonconfirming:50
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:TGTCTATGCTTGGCGTTGAG
Suggested primer 2:TGCAGATGAGGGTGAGAGTG