| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.181727 |
| Chromosome: | chromosome 3 |
| Location: | 4298481 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174672 | (1 of 1) 3.1.1.93 - Mycophenolic acid acyl-glucuronide esterase / Mycophenolic acid acyl-glucuronide deglucuronidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGGCCTGGCTCTGTCTGCCGGGTGTCAC |
| Internal bar code: | ATTGTCTGCATGCTAAAAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 131 |
| LEAP-Seq percent confirming: | 73.7079 |
| LEAP-Seq n confirming: | 328 |
| LEAP-Seq n nonconfirming: | 117 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTAAACCTTCCGTGCAT |
| Suggested primer 2: | GTCTGCTTCGACTACTCGGG |