| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.181780 |
| Chromosome: | chromosome 15 |
| Location: | 448637 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636450 | SMM58 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) K15190 - 7SK snRNA methylphosphate capping enzyme [EC:2.1.1.-] (MEPCE, BCDIN3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCATAAAATTGTCAGCCAGGAGTCACCG |
| Internal bar code: | GCCCTCGGACCAACTCACCGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 991 |
| LEAP-Seq percent confirming: | 96.1112 |
| LEAP-Seq n confirming: | 47280 |
| LEAP-Seq n nonconfirming: | 1913 |
| LEAP-Seq n unique pos: | 138 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTCCCTTCCTCTCGCTTT |
| Suggested primer 2: | GCCTGCTTTGTGAGGAAGTC |