Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.181796 |
Chromosome: | chromosome 17 |
Location: | 4528931 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g732600 | GOX5 | Glyoxal oxidase 5; (1 of 1) IPR009880//IPR011043//IPR014756//IPR015202//IPR016187 - Glyoxal oxidase, N-terminal // Galactose oxidase/kelch, beta-propeller // Immunoglobulin E-set // Domain of unknown function DUF1929 // C-type lectin fold | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGTGGTGACGGCGCGCATACCGCCCAT |
Internal bar code: | CCAAGCAAAGCAAGCTTCTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1036 |
LEAP-Seq percent confirming: | 99.3153 |
LEAP-Seq n confirming: | 5077 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGAAAGTAGGCCGTCAGGT |
Suggested primer 2: | GCTTATTTTGACACGCAGCA |