| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.181798 |
| Chromosome: | chromosome 11 |
| Location: | 3368398 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480451 | PHC42 | Putative pherophorin-chlamydomonas homolog; (1 of 71) PF12499 - Pherophorin (DUF3707) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCCTCCCTCACCACTGCCGCCCAGCCC |
| Internal bar code: | TCTCCGAGGCTCGTAGCAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 539 |
| LEAP-Seq percent confirming: | 95.1474 |
| LEAP-Seq n confirming: | 2098 |
| LEAP-Seq n nonconfirming: | 107 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGCTTAGGGCTGGGAG |
| Suggested primer 2: | CGTCGTGTGCGTCTACATCT |