Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.181800 |
Chromosome: | chromosome 12 |
Location: | 1622092 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g486300 | PSAL,PSAL1 | (1 of 1) K02699 - photosystem I subunit XI (psaL); Photosystem I reaction center subunit L | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGGGTGGTCCCAGTCCCCCAAGGATTAG |
Internal bar code: | CGGCTTACTTTTAGCCCATGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 999 |
LEAP-Seq percent confirming: | 87.0482 |
LEAP-Seq n confirming: | 867 |
LEAP-Seq n nonconfirming: | 129 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTGTCCCAGAAGGCTGAG |
Suggested primer 2: | ACACAGTGACAAGGGAAGGG |