| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.181854 |
| Chromosome: | chromosome 9 |
| Location: | 3662301 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g390578 | TRP23,FAP11 | (1 of 6) PTHR10117 - TRANSIENT RECEPTOR POTENTIAL CHANNEL; Flagellar Associated Protein 11 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGTCTCTCCTAGGAAGGTGCGGAACAGC |
| Internal bar code: | CAGTGCCTGGGCGACAAGGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 851 |
| LEAP-Seq percent confirming: | 97.9467 |
| LEAP-Seq n confirming: | 2719 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAAACAGCAACCAGGACCC |
| Suggested primer 2: | GTTGCAACCACAATGCAATC |