| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.181855 |
| Chromosome: | scaffold 19 |
| Location: | 31077 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g750297 | (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATAGCGCAGTGCGCGGCACGGTGGGCAG |
| Internal bar code: | GAGACGACGTATGTGGCGATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 168 |
| LEAP-Seq percent confirming: | 95.5556 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACTAGGAACCGATAGCCC |
| Suggested primer 2: | GGGGAAGGGAATGTTTTGTT |