Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.182011 |
Chromosome: | chromosome 12 |
Location: | 7006020 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g559850 | (1 of 1) K12880 - THO complex subunit 3 (THOC3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTATCGGCTTCCTCGACCAGCGCAGCG |
Internal bar code: | GGGGAGCGGGTTGGGATCTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 511 |
LEAP-Seq percent confirming: | 81.9455 |
LEAP-Seq n confirming: | 2165 |
LEAP-Seq n nonconfirming: | 477 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCATACCGTATCAAGGCAA |
Suggested primer 2: | TTCTGAAAGCAGAAGGGGAA |