| Insertion cassette: | CIB1 | 
| Side of cassette: | 5' | 
| Strand: | - | 
| Strain: | LMJ.RY0402.182012 | 
| Chromosome: | chromosome 9 | 
| Location: | 5020044 | 
| Confidence (%): | 95 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre09.g398104 | (1 of 1) K19306 - 18S rRNA (guanine1575-N7)-methyltransferase [EC:2.1.1.309] (BUD23) | 3'UTR | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGACGTTGAATGCTTGGTTGGCAGGCCG | 
| Internal bar code: | TTAGTGTTATCAAAAAGTTCAC | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 315 | 
| LEAP-Seq percent confirming: | 99.5529 | 
| LEAP-Seq n confirming: | 6012 | 
| LEAP-Seq n nonconfirming: | 27 | 
| LEAP-Seq n unique pos: | 5 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGGAAGGTAACAAGAGAG | 
| Suggested primer 2: | CTCTGTGACCCTCATCAGCA |