Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.182086 |
Chromosome: | chromosome 2 |
Location: | 5917078 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g111550 | (1 of 1) IPR000104//IPR000719//IPR001229//IPR002290//IPR011009//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Jacalin-like lectin domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTCACAGCCGCGTGCGACGTCTACAGGT |
Internal bar code: | GGGGCGTGTCTCATGTCCGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 312 |
LEAP-Seq percent confirming: | 77.1768 |
LEAP-Seq n confirming: | 585 |
LEAP-Seq n nonconfirming: | 173 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCCGGTTATTCCTTACCC |
Suggested primer 2: | TTCAAGGTGCACACCACATT |