| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182125 |
| Chromosome: | chromosome 9 |
| Location: | 1267686 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399400 | TGL15,FAP199 | Lipase-Domain Containing Flagellar Associated Protein 199; (1 of 22) PF01764 - Lipase (class 3) (Lipase_3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCAACATCACGCGCCAGCACTCGGCACT |
| Internal bar code: | GTCGTGTCGGGAACGAACCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 670 |
| LEAP-Seq percent confirming: | 99.5686 |
| LEAP-Seq n confirming: | 5770 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAACTGATCAGGAAACCCC |
| Suggested primer 2: | TTTGGGATATCATGGACCGT |