Insertion junction: LMJ.RY0402.182131_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.182131
Chromosome:chromosome_6
Location:7923789
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g303400 FAP16 Flagellar Associated Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTCACTGCTCCGTCCAACCACACACGCAAC
Internal bar code:GGCCCTTTGGGCACTCCCGTCT

Confirmation - LEAP-Seq

LEAP-Seq distance:952
LEAP-Seq percent confirming:99.5501
LEAP-Seq n confirming:5975
LEAP-Seq n nonconfirming:27
LEAP-Seq n unique pos:47

Suggested primers for confirmation by PCR

Suggested primer 1:GCTGTCTGCCTTACTTTGCC
Suggested primer 2:TGAGGAGTGAGAGGGAAGGA