| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.182135 |
| Chromosome: | chromosome 2 |
| Location: | 7368748 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144950 | KCN4 | Voltage-gated K+ channel; (1 of 1) PF00027//PF07885 - Cyclic nucleotide-binding domain (cNMP_binding) // Ion channel (Ion_trans_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTTGCTGACCGGTAACTCCCCTTGGAC |
| Internal bar code: | GAGTAGACGAGTCTTTGCACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 439 |
| LEAP-Seq percent confirming: | 99.5152 |
| LEAP-Seq n confirming: | 8005 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATGCAGATGCTGTGCTTG |
| Suggested primer 2: | CTGGACCTGTGGAACACCTT |