Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.182199 |
Chromosome: | chromosome 9 |
Location: | 2561465 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g390700 | POB1 | Proteome of basal body 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATCAATCATGAGTGTAGTTGGGCTTGC |
Internal bar code: | CCGAGGAGACATCAGTCCCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 84 |
LEAP-Seq percent confirming: | 99.723 |
LEAP-Seq n confirming: | 360 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGATTGCAACTTCGTCTTGC |
Suggested primer 2: | TTTTCCTTCCATCTGCATCC |