Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.182236 |
Chromosome: | chromosome 1 |
Location: | 4303792 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g029000 | COQ5D,UMM1,COQD2 | (1 of 2) PTHR10108//PTHR10108:SF813 - METHYLTRANSFERASE // SUBFAMILY NOT NAMED; Ubiquinone/menaquinone biosynthesis methyltransferase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTGGTGCGTCATTGGCTGGCGCAACGT |
Internal bar code: | TCAGGTAGAGGGATACTAAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1052 |
LEAP-Seq percent confirming: | 99.6787 |
LEAP-Seq n confirming: | 3723 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCTGCTATGGTAGGCACGG |
Suggested primer 2: | ACTACATGACCCGCCTTTTG |