| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182306 |
| Chromosome: | chromosome 5 |
| Location: | 939639 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247050 | CTR4,COPT1 | CTR type copper ion transporter; (1 of 2) K14686 - solute carrier family 31 (copper transporter), member 1 (SLC31A1, CTR1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAAGGTGCATGGATGATGGATGTGCTT |
| Internal bar code: | AGACGGGTAGGTATACGGATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 779 |
| LEAP-Seq percent confirming: | 99.8428 |
| LEAP-Seq n confirming: | 2540 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATAACCGTGCCAAGCAATC |
| Suggested primer 2: | TGGCCTACTGTCTCATGCTG |