| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182311 |
| Chromosome: | chromosome 10 |
| Location: | 5081977 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455950 | FAP407 | Flagellar Associated Protein 407; (1 of 4) K03809 - NAD(P)H dehydrogenase (quinone) (wrbA) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTTCCGGGGGTTTCGGACGCATTAGTC |
| Internal bar code: | TTGCGGTACGCTTTGGCCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 765 |
| LEAP-Seq percent confirming: | 99.6362 |
| LEAP-Seq n confirming: | 6026 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGGCACATACGAATAAGT |
| Suggested primer 2: | GATCTTCACATCAGCTGCCA |