Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.182311 |
Chromosome: | chromosome 10 |
Location: | 5081979 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g455950 | FAP407 | Flagellar Associated Protein 407; (1 of 4) K03809 - NAD(P)H dehydrogenase (quinone) (wrbA) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCGCTCTTCCCACTTGACAACATGTACT |
Internal bar code: | GCGGAGGCGGTCACGTGCGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 955 |
LEAP-Seq percent confirming: | 93.3661 |
LEAP-Seq n confirming: | 156955 |
LEAP-Seq n nonconfirming: | 11152 |
LEAP-Seq n unique pos: | 182 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGGCACATACGAATAAGT |
Suggested primer 2: | GATCTTCACATCAGCTGCCA |