| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.182312 |
| Chromosome: | chromosome 10 |
| Location: | 3253313 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443000 | ATM3 | (1 of 2) K05661 - ATP-binding cassette, subfamily B (MDR/TAP), member 6 (ABCB6); Half-size ABC transporter, membrane protein | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATCCGTTTGGGGACCTTTGCGTTGTTGG |
| Internal bar code: | TGGCTTACGTTTTAGTGTCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 411 |
| LEAP-Seq percent confirming: | 99.7722 |
| LEAP-Seq n confirming: | 438 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACATCACGCTATCACCACC |
| Suggested primer 2: | CGGTAGCCCGTATACCTCAA |